While Anthropic's dispute with the Pentagon escalated over guardrails on military use, OpenAI LLC struck its own publicized ...
When Nandakishore Leburu was building LLM applications at LinkedIn, he learned that the models weren't the problem. The ...
At the core of these advancements lies the concept of tokenization — a fundamental process that dictates how user inputs are interpreted, processed and ultimately billed. Understanding tokenization is ...
Raspberry Pis are not good for absolutely everything.
Service providers must optimize three compression variables simultaneously: video quality, bitrate efficiency/processing power and latency ...
Modality-agnostic decoders leverage modality-invariant representations in human subjects' brain activity to predict stimuli irrespective of their modality (image, text, mental imagery).
The dorsal raphe nucleus (DRN) serotonergic (5-HT) system has been implicated in regulating sleep and motor control; however, its specific role remains controversial. In this study, we found that ...
MicroPython is a well-known and easy-to-use way to program microcontrollers in Python. If you’re using an Arduino Uno Q, ...
A group of hackers used both Claude Code and ChatGPT in a cybersecurity hack that lasted two and a half months.
Neural encoding is the study of how neurons represent information with electrical activity (action potentials) at the level of individual cells or in networks of neurons. Studies of neural encoding ...
BACKGROUND: Genetic variants in components or regulators of the RAS-MAPK signaling pathway are causative for severe and early-onset hypertrophic cardiomyopathy (HCM) in patients with Noonan syndrome ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...